cisLightTM cis enhancer element reporter vector
Signal transduction pathway specific Luciferase reporter vectors for establishing stable cell lines.
Firefly luciferase reporter vectors with cis-enhancer elements are designed for quick generation of stable cell lines to assess in vivo activation of signal transduction pathways that converge at the respective cis-enhancer elements, with hygromycin or neomycin selection. They can also be used for transient assays.
cis elements include:
CRE (cyclic AMP response element)
GAS (interferon γ activated sequence)
ISRE (interferonstimulated response element)
AP1 (activator protein 1)
NFAT (nuclear factor of activated T cells)
NFκB (binding sites for nuclear factor κB, NFkB).
Cloning vectors (pHTS-hyg-MCS or pHTS-Neo-MCS) are also available so that one can create synthetic promoters to monitor new signaling pathways of interest.
Specifications
Materials Provided: | 40 ug transfection ready plasmids in 80ul TE buffer pHTS-MCS cloning vector 10 ug in 20ul TE Sequencing primer Luc-B1: 0.5nmole/50 ul TE Sequencing primer sequence: 5'gcagttgctctccagcggttccat3' |
---|
Antibiotic Selections: | Hygromycin or Neomycin selection for stable cell establishment Ampicillin for bacterial selection |
---|
Maintenance of plasmid clones
Upon receiving of the plasmids, briefly spin the vials to collect contents to the bottom before storing at 2-8oC if will be used shortly, or -20 oC for long term storage. It is recommended that you propagate the vectors in E. coli strains that are recombinant deficient (recA) and endonuclease A-deficient (endA) (e.g. DH5α or XL1-Blue).
Cloning custom sequences
All pHTS vectors have the same basic structure as pHTS-MCS except that the MCS sequence is replaced with tandem repeats of different enhancer elements as shown below. For example, the junction of the synthetic promoter and luciferase in pHTS-NFkB has the following sequence:
5'GGATCCAAGCTAGGGGACTTTCCGCTGGGGACTTTCCGCTGGGGACTTTCCGC
TGGGGACTTTCCGCTGGGGACTTTCCGCGGTGACTCTAGAGGGTATATAATGGAAG
CTCGAATTCCAGCTTGGCATTCCGGTACTGTTGGTAAAATG(Luciferase) 3'
Complementary oligos of chosen cis-response elements may be synthesized and annealed with appropriate overhangs to be cloned in between Sma I and SalI of pHTS-MCS. For example, the following annealed dsDNA can be inserted into the SalI site of pHTS-MCS to create a reporter vector that is responsive to TGF-β:
5'TCGATCTCAATCCACAATCTCGGAGTATGTCTAGACTGACAATG 3'
3' AGAGTTAGGTGTTAGAGCCTCATACAGATCTGACTGTTACAGCT5'
Transfection and selection
The pHTS vectors are available with either the hygromycin or neomycin phosphotransferase expression cassette for mammalian cell selection for stable cell lines with hygromycin or Geneticine (G418), respectively. A killing curve with various hygromycin or G418 concentrations should be determined empirically for each cell line. Concentrations of hygromycin ranging from 50 to 500ug/ml or higher have been reported for mammalian cell selections. G418 can be used at 300ug/ml to 1mg/ml.
Luciferase Assay
Use of a commercial luciferase assay may be more convenient. The following protocol is provided for quick reference only.
- Remove media from cell and rinse twice with PBS and remove residual PBS
- Add 1x Lysis Buffer (e.g. 400ul per well of a six-well plate, see below for buffer components). Incubate the plate for 15 minutes at room temperature (RT) with gentle rocketing.
- The lysates could be used in luciferase assay or be transferred to microcentrifuge tubes and stored at -80oC
- Mix 5-20ul of cell lysate with 100ul of 1X Luciferase Assay Buffer in an appropriate tube (e.g. Falcon 2054 polystyrene tube). All reagents should be brought to RT for assay.
- Measure the light emission with a luminometer with an integration time of 10-30 seconds.
5X Lysis Buffer: Tricine (pH7.8) 40mM; NaCl 50mM; EDTA 2mM; MgSO4 1mM; DTT 5mM; Triton X-100 1%.
Assay Buffer (1x): Tricine (pH7.8) 40mM; ATP 0.5mM; MgSO4 10mM; EDTA 0.5mM; DTT 10mM; Coenzyme A 0.5mM and luciferin 0.5mM.
Vector Map